Methods

PCR offers far and away the most convenient method for identifying chlamydiae. The families Chlamydiaceae, Parachlamydiaceae, Simkaniaceae, and Waddliaceae are easily distinguished on the basis of their ribosomal gene sequences which, together with phenotypic and pathologic properties, forms the basis of current chlamydial taxonomy. A 23S rRNA signature sequence that can be PCR amplified and directly sequenced to identify Chlamydiales families and species has been characterized [see: Table 1]. This PCR product for all Chlamydiaceae can be cut with the restriction enzyme PbrP1 [Everett et al., 1999a]. Additional 23S rRNA identification by PCR sequencing may be performed using the target sequences of I-CeuI and the 5S rRNA [see: Table 1; Bush & Everett, 2001; Everett & Andersen, 1997; Everett et al., 1999a; 1999b]. Full-length 16S rRNA sequences of new members of the Parachlamydiaceae have been amplified with primers developed by Pudjiatmoko et al., 1997. The work of Ossewaarde and Meijer, 1999 indicates that there are many additional unknown chlamydia-like lineages [see: Chlamydiales diversity]. For other possible primer sequences see the references below and also the articles on this site on quantitative PCR and on in situ hybridization.

Table 1. Oligonucleotide primers for the identification of chlamydiae by two step PCR, using 72ºC for annealing and extension and 94ºC for melting. Taken from Everett (2000).

PCR Test and source of information	Primer Name	Primer sequence
Multiplex, MOMP-tRNA product and rRNA intergenic spacer product. (Everett et al., 1999b). Detects all Chlamydiaceae	IGF IGR 1260 TGLY	5' GACTAGGTTGGGCAAG 3' 5' AGCTCTTA(t/g/a)(c/t)AACTTGGTCTGTA 3' 5' CGCTTAATC(a/g)A(t/c)GAAAGAGCTGCTCA 3' 5' GGCTACAGCTCTACCATTGA 3'
TaqMan test for TaqMan Sequence Detection System, 23S rRNA target (Everett et al., 1999b). Detects all *Chlamydiaceae*	TQF Probe TQR	5' GAAAAGAACCCTTGTTAAGGGAG 3' 5' FAM-CAAAAGGCACGCCGTCAAC-TAMRA 3' 5' CTTAACTCCCTGGCTCATCATG 3'
23S rRNA signature sequence. (Everett et al., 1999a). Detects all *Chlamydiales*	U23F 23SIGR	5' GATGCCTTGGCATTGATAGGCGATGAAGGA 3' 5' TGGCTCATCATGCAAAAGGCA 3'
16S rRNA signature sequence. (Everett et al., 1999a). Detects all *Chlamydiales*	16SIGF 16SIGR	5' CGGCGTGGATGAGGCAT 3' 5' TCAGTCCCAGTGTTGGC 3'
16S rRNA signature sequence (Ossewaarde and Meijer, 1999). Detects all Chlamydiales, with no cross-reaction to any hosts that have been tested, including human, chicken, cat, crocodile, cow, pig, and snake	Forward Reverse	5' GTGGATGAGGCATGCGAGTCGA 3' 5' CGTGGATGAGGCATGCAAGTCGA 3' 5' CTCTCAGCCCGCCTAGACGTCTTAG 3' 5' CAATCTCTCAATCCGCCTAGACGTCTTAG 3' 5' ATCTCTCAATCCGCCTAGACGTCAAAG 3' 5' ATCTCTCAATCCGCCTAGACGTCAAAA 3' 5' CAATCTCTCAATCCGCCTAGACGTCATAG 3'
Full-length 16S rRNA (>1500 bp). Detects all Chlamydiales	16SF 16SR	5' GCGTGGATGAGGCATGCAA 3' 5' GGAGGTGATCCAGCCCCA 3'
PCR-RFLP (Everett and Andersen, 1999). Distinguishes nine Chlamydiaceae species	16SF2 23R	5' CCGCCCGTCACATCATGG 3' 5' TACTAAGATGTTTCAGTTC 3'

In another approach to speciation, Griffiths and Gupta 2002 identified a number of insertion/deletions (indels) that were unique and distinctive of the chlamydial species. These included one 16 amino acid, and two single amino acid inserts in the enzyme UDP-N-acetylglucosamine 1-carboxyvinyltransferase (MurA), one amino acid inserts in protein synthesis elongation factor P (EF-P), in the Mg⁺⁺ transport protein (MgtE) and carboxy-terminal protease and a one amino acid deletion in the tRNA (guanine-N(1)-)-methyltransferase (TrmD) protein. The homologues of these proteins are found in all major groups of bacteria and the observed indels are present in all available chlamydial sequences but not in any other species (except for the large insert in MurA in Streptomyces). The validity of three of these signatures (MurA, EF-P and MgtE) was tested by PCR-amplifying the signature regions from several chlamydial species for which no sequence information was available. All Chlamydiaceae species for which specific fragments could be amplified (Chlamydia suis, Chlamydophila abortus, Chlamydophila psittaci, Chlamydophila felis) contained the expected signatures. A fragment of the murA gene from Waddlia chondrophila and the efp gene from Simkania negevensis were also cloned and sequenced. The presence of these respective indels in these species provided strong evidence that they are indeed specifically related to the traditional species in the Chlamydiaceae, and that these signatures may be distinctive of the entire Chlamydiales order. A 17 amino acid conserved indel was also identified in the cell wall biosynthesis enzyme UDP-N-acetylglucosamine pyrophosphorylase (GlmU), which is shared by all archaeal and chlamydial homologues. This suggests the gene for this protein was horizontally transferred from an archaeon to the chlamydial last common ancestor. The results also supported a lateral transfer of the murA gene between chlamydiae and Streptomyces. The large inserts in these peptidoglycan synthesis-related genes in chlamydiae might account for their unusual cell-wall characteristics. These signatures are also potentially useful for screening chlamydial species.

References

Bush, R. M. & Everett, K. D. E. (2001). Molecular Evolution of the Chlamydiaceae. International Journal of Systematic and Evolutionary Microbiology 51, 203 - 220.

Loy, A., Horn, M., Wagner, M. (2003). probeBase - an online resource for rRNA-targeted oligonucleotide probes. Nucleic Acids Res., 31(1), [In press]. See: probeBase

PCR probes for the identification of chlamydiae

References